Oporność na tyreotropinę wywołaną przez mutacje w genie receptora tyreotropiny czesc 4

Wzrost dziewcząt nadal był normalny. Tabela 2. Tabela 2. Odpowiedzi na administrację T3 w najstarszej córce (córka 1) w rodzinie z opornością na tyyropinę i dziewięciu normalnych podmiotów. Wyniki podawania dwóch dawek T3 najstarszej córce przedstawiono w Tabeli 2. Ułamkowe zmniejszenie stężenia tyreotropiny w surowicy i zmiany stężenia globuliny wiążącej hormon płciowy w surowicy, fosfatazy alkalicznej, cholesterolu i kreatyny były prawidłowe, wskazując normalna wrażliwość przysadki tarczycy i tkanek obwodowych na hormon tarczycy. Ponadto zmniejszeniu stężenia tyreotropiny w surowicy towarzyszył spadek stężenia T4 i wartości T4 w surowicy, co wskazuje, że wydzielanie hormonu tarczycy było zależne od tyreotropiny.
Region kodujący z 10 klonów genu thyrotropin . wyizolowanego od najstarszej córki miał normalne sekwencje. Wynik ten wskazywał, że defekt nie obejmował podjednostki . tyreotropiny, która nadaje aktywność biologiczną hormonu, a zatem nieprawidłowość była najprawdopodobniej w kroku pośredniczącym w działaniu tyreotropiny.
Ryc. 1. Ryc. 1. Żel sekwencyjny pokazujący mutacje w eksonie 6 receptora tyreotropiny w najstarszej córce rodziny o oporności na tyypropinę. G oznacza guaninę, adeninę, T tyminę i C cytozynę. Podstawione nukleotydy (G dla C i A dla T) są otoczone kolorem czarnym.
Następnie gen receptora tyreotropiny najstarszej córki został zsekwencjonowany w całości. Różne substytucje nukleotydów wykryto w każdym z dwóch alleli (Figura 1), wskazując na obecność heterozygotyczności związku. Obie mutacje zlokalizowane były w eksonie 6, który koduje część środkową zewnątrzkomórkowej domeny receptora tyreotropinowego. W jednym allelu normalna tymina w pozycji 599 została zastąpiona przez adeninę, co spowodowało zastąpienie izoleucyny asparaginą w pozycji 167. W innym allelu normalna cytozyna w pozycji 583 została zastąpiona guaniną, co spowodowało zastąpienie proliny przez alaninę w pozycji 162. Ten ostatni allel zawierał również wcześniej opisany wariant polimorficzny w eksonie (treonina [ACC] zamiast proliny [CCC] w pozycji 52) .11
Rycina 2. Ryc. 2. Potwierdzenie mutacji w genie receptora tyreotropiny w członkach rodziny badawczej. Genomowy DNA z leukocytów krwi obwodowej amplifikowano w oddzielnych reakcjach PCR z użyciem tego samego antysensownego startera (5 -actggtaatactcacAGTGTCA3 ) i z dwoma zdegenerowanymi starterami sensownymi: 5 ACAGACAACCCTTACATGACTTTAA3 , który tworzy miejsce restrykcyjne Dra1 w obecności adeninę w pozycji 599 i 5 ctcttgcagTGAAATTGCAGAC3 , która wytwarza miejsce restrykcyjne Mw oI w obecności guaniny w pozycji 583 (zdegenerowane nukleotydy są podkreślone, a sekwencje intronowe są małymi literami). Górny żel pokazuje, że ojciec i jego trzy córki mają zmutowany allel zawierający adeninę w pozycji 599, która jest trawiona DraI (D2), produkując fragment DNA o wielkości 63 pz i allel odporny na trawienie DraI (D1) zawierający tyminę zwykle znajdującą się w pozycji 599
[podobne: lekarz rodzinny września, biochrom, kto moze oddac krew ]

Powiązane tematy z artykułem: biochrom kto moze oddac krew lekarz rodzinny września